igg2a isotype control (R&D Systems)

R&D Systems is a verified supplier

R&D Systems manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

R&D Systems igg2a isotype control
Igg2a Isotype Control, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 103 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+igg2a/Mouse+IgG2A+Isotype+Control/pmc13120630-63-27-32
Average 93 stars, based on 103 article reviews

igg2a isotype control - by Bioz Stars, 2026-09

93/100 stars

Images

Genotyping:

Article Title: Netrin 1 directs vascular patterning and maturity in the developing kidney
Article Snippet: .. List of primers used for genotyping, in situ hybridization probes, and qPCR Col15a1_R GTAGAGGATAACCCGCTGGC Ltbp4_F CTGGGTGTCGCTATTGGTG Ltbp4_R GTTGTGACAGATCAAGGGACAT Actg2_F CCGCCCTAGACATCAGGGT Actg2_R TCTTCTGGTGCTACTCGAAGC Crabp1_F CAGCAGCGAGAATTTCGACGA, Crabp1_R CGCACAGTAGTGGATGTCTTGA Vim_F CGTCCACACGCACCTACAG Vim_R GGGGGATGAGGAATAGAGGCT Col4a1_F CTGGCACAAAAGGGACGAG Col4a1_R ACGTGGCCGAGAATTTCACC Tgfb1_F CTCCCGTGGCTTCTAGTGC Tgfb1_R GCCTTAGTTTGGACAGGATCTG Hey1_F GCGCGGACGAGAATGGAAA Hey1_R TCAGGTGATCCACAGTCATCTG Acta2_F GTCCCAGACATCAGGGAGTAA Acta2_R TCGGATACTTCAGCGTCAGGA Antibody Host /Isotype Concentration (section) Concentration (wholemount) Company Catalog # Six2 Rabbit 1:1000 1:250 ProteinTech 11562-1-AP Netrin-1 Chicken 1:100 NA Abcam ab39370 CD31 Rat 1:100 1:50 BD Biosciences 550274 SMA-488 Mouse IgG2a NA 1:250 Invitrogen 53-9760-82 Cytokeratin Mouse IgG1 1:500 1:250 Sigma C2931 Ecad Rat 1:500 1:250 Fisher 131900 AlexaFluor Azide Dye (EdU) NA 1:500 NA ThermoFish er A10266 CD146 (Mcam) Rat 1:1000 1:250 BioLegend 164701 Tubb3 (Tuj1) Mouse IgG2a 1:1000 1:250 BioLegend 801202 Tubb3-594 (Tuj1) Mouse IgG2a 1:1000 1:250 BioLegend 818001 Flk1 Goat 1:250 NA R&D Systems AF644 TER119 Rat 1:250 NA BD Biosciences 553670 Lhx1 Mouse IgG1 1:100 NA DSHB 4F2 Wt1 Rabbit 1:500 NA Abcam ab89901 D ev el o pm en t • S up pl em en ta ry in fo rm at io n Table S5. ..

In Situ Hybridization:

Real-time Polymerase Chain Reaction:

Concentration Assay:

Incubation:

Article Title: C5aR expression in kidney tubules, macrophages and fibrosis.
Article Snippet: .. Primary antibodies or their respective mouse IgG2a (R&D Systems [Minneapolis, MN, U.S.A.] Cat# MAB003, RRID: AB_357345) or rat IgG2a (BD Biosciences [Franklin Lakes, NJ, U.S.A.] Cat# 559478, RRID:AB_10056899) isotype controls were added to the samples at 2 μg/ml for overnight incubation at 4°C. .. Sections were washed four times with 1% goat serum PBS-T for 5 min each, then incubated with 1:1000 diluted, horseradish peroxidase (HRP)-conjugated secondary antibodies as appropriate (Jackson ImmunoResearch Labs [West Grove, PA, U.S.A.] goat anti-rat Cat# 112-035-167, RRID:AB_2338139, and goat antimouse Cat# 115-035-062, RRID:AB_2338504) in 1% PBS-T for 1 hr at RT, after which diaminobenzidine substrate (Vector Laboratories [Newark, CA, U.S.A.] SK-4105) was applied for 5 min and rinsed before counterstain with Mayer’s.

other:

Article Title: 3D Compartmentalised Human Pluripotent Stem Cell–derived Neuromuscular Co-cultures
Article Snippet: Mouse IgG2a anti TUBB3 (R&D Systems, catalog number: MAB1195, clone: Tuj1); store single aliquots at -80 °C 33.

Review